Home / Science / Former UCSD prof who resigned amid investigation into China ties has paper flagged for using the wrong test – Retraction Watch

Former UCSD prof who resigned amid investigation into China ties has paper flagged for using the wrong test – Retraction Watch

Former UCSD prof who resigned amid investigation into China ties has paper flagged for using the wrong test – Retraction Watch

Kang Zhang

Science Translational Medicine has issued an expression of concern a few 2020 paper on the genetics of colorectal most cancers by a bunch in China whose outcomes have been pegged on a test that couldn’t have produced the findings. 

The article, “Circulating tumor DNA methylation profiles enable early diagnosis, prognosis prediction, and screening for colorectal cancer,” appeared in January, with authors from each academia and an outfit referred to as the Guangzhou Youze Biological Pharmaceutical Technology Company. 

One member of the group is Kang Zhang, who resigned his submit at the University of California, San Diego final yr after experiences of undisclosed ties to China. In March, as we reported, Zhang retracted a paper from PNAS as a result of a few of its photographs have been taken from different researchers’ work.

In 2012, based on inewsource, Zhang — whose affiliations are listed as Sichuan University and the Macau University of Science and Technology, the latter of which was listed on his now-retracted PNAS paper  —  based the Guangzhou Kangrui Biological Pharmaceutical Technology Co., which seems to be the similar entity as Guangzhou Youze. 

The summary of the Science Translational Medicine article reads: 

Circulating tumor DNA (ctDNA) has emerged as a helpful diagnostic and prognostic biomarker in lots of cancers. Here, we carried out a research to research the potential use of ctDNA methylation markers for the prognosis and prognostication of colorectal most cancers (CRC) and used a potential cohort to validate their effectiveness in screening sufferers at excessive threat of CRC. We first recognized CRC-specific methylation signatures by evaluating CRC tissues to regular blood leukocytes. Then, we utilized a machine studying algorithm to develop a predictive diagnostic and a prognostic mannequin using cell-free DNA (cfDNA) samples from a cohort of 801 sufferers with CRC and 1021 regular controls. The obtained diagnostic prediction mannequin discriminated sufferers with CRC from regular controls with excessive accuracy (space beneath curve = zero.96). The prognostic prediction mannequin additionally successfully predicted the prognosis and survival of sufferers with CRC (P < zero.001). In addition, we generated a ctDNA-based molecular classification of CRC using an unsupervised clustering technique and obtained two subgroups of sufferers with CRC with considerably completely different total survival (P = zero.011 in validation cohort). Last, we discovered that a single ctDNA methylation marker, cg10673833, may yield excessive sensitivity (89.7%) and specificity (86.eight%) for detection of CRC and precancerous lesions in a high-risk inhabitants of 1493 contributors in a potential cohort research. Together, our findings confirmed the worth of ctDNA methylation markers in the prognosis, surveillance, and prognosis of CRC.

Or, as the journal put it in a abstract of the paper titled “Methylation marks the spot”: 

The detection of circulating tumor DNA in the blood is a noninvasive technique that will assist detect most cancers at early levels if one is aware of the right markers for analysis. Luo et al. analyzed methylation patterns in blood samples from a number of giant cohorts of sufferers, together with a potential screening cohort of individuals at excessive threat of colorectal most cancers. The authors recognized and validated a methylation-based diagnostic rating to assist distinguish sufferers with colorectal most cancers from wholesome controls, in addition to a prognostic rating that correlated with sufferers’ survival. One methylation marker specifically appeared to have excessive sensitivity and specificity for figuring out sufferers with most cancers.

But one thing was amiss. According to the expression of concern

On 1 January 2020, Science Translational Medicine printed the Research Article “Circulating tumor DNA methylation profiles enable early diagnosis, prognosis prediction, and screening for colorectal cancer” by H. Luo, Q. Zhao, W. Wei, L. Zheng, S. Yi, G. Li, W. Wang, H. Sheng, H. Pu, H. Mo, Z. Zuo, Z. Liu, C. Li, C. Xie, Z. Zeng, W. Li, X. Hao, Y. Liu, S. Cao, W. Liu, S. Gibson, Okay. Zhang, G. Xu, R.-h. Xu (1). Subsequently, it was dropped at our consideration that the methylation standing at cg10673833 couldn’t have been measured using the Behavioral Diagnostics assay indicated in the Materials and Methods, as a result of this assay solely detects methylation at cg05575921. When Science Translational Medicine queried the authors, they offered a distinct description of their strategies, stating that the primers and probes for their PCR-based assay have been custom-designed and ordered from Thermo Fisher Scientific. However, it stays unclear why the misguided details about the Behavioral Diagnostics assay was offered in the Materials and Methods. Given our persevering with considerations about how precisely methylation at cg10673833 was measured—the basis upon which the outcomes on this Research Article are based mostly—Science Translational Medicine is publishing an Editorial Expression of Concern along with an erratum to alert the scientific neighborhood to those considerations.  

Rui-Hua Xu, a professor at Sun Yat-sen University Cancer Center, and the corresponding writer of the research, denied that something was wrong with the paper past a easy mistake in the provenance of the assay: 

First of all, let me state that our digital droplet PCR assay is legitimate and there’s nothing wrong in our methodology, or reagent supplies.

All important info of our methylation assay on cg10673833, together with cell free DNA isolation, bisulfite conversion, the droplet PCR primer sequences and the assay situation, are precisely the similar as our preliminary submission and stays to be efficient, as we wrote in the erratum [see below]. 

Xu informed us that the researchers used reagents from one firm for their preliminary experiments, then switched: 

We made a mistake of the vendor info once we wrote the paper, we really feel very sorry about this error in penning this paper however it’s an unintentional error. We really feel regretful about the determination of EoC however respect STM. We have corrected the vendor info, offered a extra element protocol and launched the prime sequences of cg10673833 in the erratum which will probably be printed with EoC concurrently. We want to emphasize that our ddPCR assay is powerful, and have been reproduced many instances. We are glad to produce related primers and reagents  to different labs in the world to duplicate/affirm our outcomes.

This is the Erratum:

In the Research Article “Circulating tumor DNA methylation profiles enable early diagnosis, prognosis prediction, and screening for colorectal cancer,” the process for performing droplet digital PCR was incorrect in the Supplementary Materials and Methods. The authentic textual content said that “an aliquot of every pattern was pre-amplified, diluted 1: 3000, after which PCR-amplified using fluorescent, dual-labeled primer-probe units particular for cg10673833 from Behavioral Diagnostics (accessible for sale by way of IBI Scientific, www.ibisci.com) and Universal Digital PCR reagents and protocols from Bio-Rad.” The authors have corrected this textual content to point that “the PCR primers and twin labeled fluorescent probes in the ddPCR assay have been as following: ahead primer, 5′- GTTTTATAAGGAGGTTGTGTT; reverse primer, 5′-AACIAAAAACCCTCCAAA; probe for methylated allele detection, 5′- FAM/GAGGGGTCGGATGTTGG/BHQ1-Three′; and probe for unmethylated allele detection, 5′-HEX/GAGGGGTTGGATGTTGGG/BHQ1-Three′. The following biking situations have been used: 98°C for 10 min, adopted by 40 cycles at 98°C for 30 s and 53°C for 60 s, and at last 98°C for 10 min. The primers and probes have been customized and synthesized by Thermo Fisher Scientific (www.thermofisher.com/cn/en/residence/life-science/oligonucleotides-primers-probes-genes/applied-biosystems-custom-primers-probes.html). The ddPCR Supermix for Probes (Cat.18630125) and different common Digital PCR reagents and protocols have been bought from Bio-Rad (www.bio-rad.com/en-cn/class/digital-pcr?ID=M9HE2R15).” The Supplementary Materials PDF has been corrected.

Like Retraction Watch? You could make a tax-deductible contribution to help our work, observe us on Twitter, like us on Facebook, add us to your RSS reader, or subscribe to our day by day digest. If you discover a retraction that’s not in our database, you may tell us right here. For feedback or suggestions, e-mail us at crew@retractionwatch.com.

About Agent

Check Also

Did Rain Trigger 2018 Kilauea Eruption in Hawaii? | Science

Did Rain Trigger 2018 Kilauea Eruption in Hawaii? | Science Forget the flowers: Sometimes April …

Leave a Reply

Your email address will not be published. Required fields are marked *